Online Inquiry
KLF10 Knockout Cell Line
SPL-01839
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | KLF10 |
| Gene Abbr. | KLF10 |
| Gene ID | 7071 |
| Full Name | Kruppel like factor 10 |
| Alias | EGR-alpha, EGRA, TIEG, TIEG1 |
| Species | Human |
| Genomic Locus | chr8:102652222 |
| Transcript | NM_005655 |
| WT Expression Level | 5.09 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of a family of proteins that feature C2H2-type zinc finger domains. The encoded protein is a transcriptional repressor that acts as an effector of transforming growth factor beta signaling. Activity of this protein may inhibit the growth of cancers, particularly pancreatic cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of KLF10. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAATCAGATACTGGTGTAAC |
| PCR Primer |
Forward: ACTGTAAGGTGGAGTCAAACACTAA Reverse: TCTGAAAGGCCAAAAGAGAGTATGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.