Online Inquiry
KDM5C Knockout Cell Line
SPL-01827
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
5bp deletion |
Target Information | |
---|---|
Target Name | JARID1C |
Gene Abbr. | KDM5C |
Gene ID | 8242 |
Full Name | lysine demethylase 5C |
Alias | DXS1272E, JARID1C, MRX13, MRXJ, MRXSCJ |
Species | Human |
Genomic Locus | chrX:53224761 |
Transcript | NM_004187 |
WT Expression Level | 55.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene is a member of the SMCY homolog family and encodes a protein with one ARID domain, one JmjC domain, one JmjN domain and two PHD-type zinc fingers. The DNA-binding motifs suggest this protein is involved in the regulation of transcription and chromatin remodeling. Mutations in this gene have been associated with X-linked mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of KDM5C. |
Description | 5bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AATGCCCGATTTCTCTGCGA |
PCR Primer |
Forward: TCTTAAACCCGGAGTGATTCTGAAG Reverse: GGGGTCCGACGATTTCCTAC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.