Online Inquiry
KDM4E Knockout Cell Line
SPL-01824
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | KDM4E |
| Gene Abbr. | KDM4E |
| Gene ID | 390245 |
| Full Name | lysine demethylase 4E |
| Alias | JMJD2E, KDM4DL, KDM5E |
| Species | Human |
| Genomic Locus | chr11:95025671 |
| Transcript | NM_001161630 |
| WT Expression Level | 0.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this intronless gene is a member of a large family of histone lysine demethylases, which use oxygen and 2-oxoglutarate to demethylate di- and trimethylated lys9 of histone H3. Derepression of genes by demethylases is sometimes involved in viral infection or carcinogenesis, so inhibitors of these enzymes are desired. [provided by RefSeq, Dec 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of KDM4E. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGCCAGCTTGATGTGCGCCT |
| PCR Primer |
Forward: AGTATACTGACTAGAGTGGAGTCCC Reverse: CACCCTCATGGCTTTCTTCTTTTTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.