KDM1A Knockout Cell Line - CD BioSciences

service-banner

KDM1A Knockout Cell Line

KDM1A Knockout Cell Line

SPL-01816

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name LSD1
Gene Abbr. KDM1A
Gene ID 23028
Full Name lysine demethylase 1A
Alias AOF2, BHC110, CPRF, KDM1, LSD1
Species Human
Genomic Locus chr1:23030612
Transcript NM_001009999
WT Expression Level 175.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a nuclear protein containing a SWIRM domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of KDM1A.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence AAGTGAGCCTGAAGAACCAT
PCR Primer Forward: AGAGTACAGAGAGATGGATGAAAGC
Reverse: GGCAGGAGACTCAATATCAGACTTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.