Online Inquiry
KDELR1 Knockout Cell Line
SPL-01812
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
298bp insertion |
Target Information | |
---|---|
Target Name | KDELR1 |
Gene Abbr. | KDELR1 |
Gene ID | 10945 |
Full Name | KDEL endoplasmic reticulum protein retention receptor 1 |
Alias | ERD2, ERD2.1, HDEL, PM23 |
Species | Human |
Genomic Locus | chr19:48391339 |
Transcript | NM_006801 |
WT Expression Level | 144.34 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, which is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. The protein encoded by this gene was the first member of the family to be identified, and it encodes a protein structurally and functionally similar to the yeast ERD2 gene product. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 298bp insertion in a coding exon of KDELR1. |
Description | 298bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | ATGAATCTCTTCCGATTCCT |
PCR Primer |
Forward: AGACCCAGAACCTAGAAGAGAGAT Reverse: CAAGTTCCTATGGGGCAGCTTT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.