Online Inquiry
KCNQ2 Knockout Cell Line
SPL-01809
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | KCNQ2 |
| Gene Abbr. | KCNQ2 |
| Gene ID | 3785 |
| Full Name | potassium voltage-gated channel subfamily Q member 2 |
| Alias | BFNC, DEE7, EBN, EBN1, ENB1 |
| Species | Human |
| Genomic Locus | chr20:63445342 |
| Transcript | NM_172109 |
| WT Expression Level | 16.11 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of KCNQ2. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATCGTGACTATCGTGGTGTT |
| PCR Primer |
Forward: GACATTTAGGCAGAGTTAACCACAG Reverse: GGTCAGCTTGCAGTTTCCTTTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.