KCNQ1 Knockout Cell Line - CD BioSciences

service-banner

KCNQ1 Knockout Cell Line

KCNQ1 Knockout Cell Line

SPL-01806

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name KCNQ1
Gene Abbr. KCNQ1
Gene ID 3784
Full Name potassium voltage-gated channel subfamily Q member 1
Alias ATFB1, ATFB3, JLNS1, KCNA8, KCNA9
Species Human
Genomic Locus chr11:2571344
Transcript NM_000218
WT Expression Level 0.43 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of KCNQ1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence CTCCATGGTGGTCCTCTGCG
PCR Primer Forward: GAGGTTGGGTCTCTCCGTTTAGAT
Reverse: TTACCACCCAAGTCCTGGAAGTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.