Online Inquiry
KCNK2 Knockout Cell Line
SPL-01803
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | KCNK2 |
| Gene Abbr. | KCNK2 |
| Gene ID | 3776 |
| Full Name | potassium two pore domain channel subfamily K member 2 |
| Alias | K2p2.1, TPKC1, TREK, TREK-1, TREK1 |
| Species | Human |
| Genomic Locus | chr1:215086501 |
| Transcript | NM_001017424 |
| WT Expression Level | 13.99 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes one of the members of the two-pore-domain background potassium channel protein family. This type of potassium channel is formed by two homodimers that create a channel that leaks potassium out of the cell to control resting membrane potential. The channel can be opened, however, by certain anesthetics, membrane stretching, intracellular acidosis, and heat. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of KCNK2. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACGGTCTCCACGATATTCC |
| PCR Primer |
Forward: CCTTCTCTGACCCCTTAAAGAAGAA Reverse: TTGGGATATGAATGTTTGCTTCTGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.