Online Inquiry
KCND2 Knockout Cell Line
SPL-01795
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 61bp deletion |
| Target Information | |
|---|---|
| Target Name | KCND2 |
| Gene Abbr. | KCND2 |
| Gene ID | 3751 |
| Full Name | potassium voltage-gated channel subfamily D member 2 |
| Alias | KV4.2, RK5 |
| Species | Human |
| Genomic Locus | chr7:120274947 |
| Transcript | NM_012281 |
| WT Expression Level | 1.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 61bp deletion in a coding exon of KCND2. |
| Description | 61bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGCACTCGTGGCGAGGATAG |
| PCR Primer |
Forward: ACTCTACTGGGCAGTTCTGAGAG Reverse: GAAAAACCCCGTGACATAGTAGAAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.