Online Inquiry
KCNC1 Knockout Cell Line
SPL-01794
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 83bp insertion |
| Target Information | |
|---|---|
| Target Name | KCNC1 |
| Gene Abbr. | KCNC1 |
| Gene ID | 3746 |
| Full Name | potassium voltage-gated channel subfamily C member 1 |
| Alias | EPM7, KV3.1, KV4, NGK2 |
| Species | Human |
| Genomic Locus | chr11:17736351 |
| Transcript | NM_001112741 |
| WT Expression Level | 0.29 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of a family of integral membrane proteins that mediate the voltage-dependent potassium ion permeability of excitable membranes. Alternative splicing is thought to result in two transcript variants encoding isoforms that differ at their C-termini. These isoforms have had conflicting names in the literature: the longer isoform has been called both 'b' and 'alpha', while the shorter isoform has been called both 'a' and 'beta' (PMIDs 1432046, 12091563). [provided by RefSeq, Oct 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 83bp insertion in a coding exon of KCNC1. |
| Description | 83bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAGGCTCTGGACAGCTTCGG |
| PCR Primer |
Forward: CTGAACTACTACCGCACGGG Reverse: GCTCTTCTGATGGGTAAATTGTCAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.