Online Inquiry
KAT2B Knockout Cell Line
SPL-01783
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 31bp deletion |
| Target Information | |
|---|---|
| Target Name | PCAF |
| Gene Abbr. | KAT2B |
| Gene ID | 8850 |
| Full Name | lysine acetyltransferase 2B |
| Alias | CAF, P/CAF, PCAF |
| Species | Human |
| Genomic Locus | chr3:20072436 |
| Transcript | NM_003884 |
| WT Expression Level | 4.55 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 31bp deletion in a coding exon of KAT2B. |
| Description | 31bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGCATGGCTACAACTCCGAC |
| PCR Primer |
Forward: CTTGAAAGGAAGAAGGGACAAAGTC Reverse: CACGGCTGCCTGTTAAATAATTTTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.