Online Inquiry
KAT2A Knockout Cell Line
SPL-01781
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp deletion |
| Target Information | |
|---|---|
| Target Name | GCN5L2 |
| Gene Abbr. | KAT2A |
| Gene ID | 2648 |
| Full Name | lysine acetyltransferase 2A |
| Alias | GCN5, GCN5L2, PCAF-b, hGCN5 |
| Species | Human |
| Genomic Locus | chr17:42120991 |
| Transcript | NM_021078 |
| WT Expression Level | 90.74 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]).[supplied by OMIM, Sep 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of KAT2A. |
| Description | 1bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTCTCAAGCTTCTTGGCGCG |
| PCR Primer |
Forward: GGTTTTTCCAGCCATTACACTTACA Reverse: AAGAGATTACAAGTGAAGAGGGGTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.