Jun cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Jun cDNA ORF Clone, Mouse, C-His tag

Jun cDNA ORF Clone, Mouse, C-His tag

SPD-03416

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse jun proto-oncogene with C terminal His tag.
Target Information
Species Mouse
Target Name c-Jun
Gene Abbr. Jun
Gene ID 16476
Full Name jun proto-oncogene
Alias AP-1, Junc, c-ju, c-jun
Introduction c-Jun is a member of the Jun family containing c-Jun, JunB, and JunD, and is a component of the transcription factor activator protein-1 (AP-1). AP-1 is composed of dimers of Fos, Jun, and ATF family members and binds to and activates transcription at TRE/AP-1 elements. Extracellular signals including growth factors, chemokines, and stress activate AP-1-dependent transcription. The transcriptional activity of c-Jun is regulated by phosphorylation at Ser63 and Ser73 through SAPK/JNK. Knock-out studies in mice have shown that c-Jun is essential for embryogenesis and subsequent studies have demonstrated roles for c-Jun in various tissues and developmental processes including axon regeneration liver regeneration and T cell development. AP-1 regulated genes exert diverse biological functions including cell proliferation, differentiation, and apoptosis, as well as transformation, invasion and metastasis, depending on cell type and context. Other target genes regulate survival, as well as hypoxia and angiogenesis. Research studies have implicated c-Jun as a promising therapeutic target for cancer, vascular remodeling, acute inflammation, and rheumatoid arthritis.
Product Details
Description Full length Clone DNA of Mouse jun proto-oncogene with C terminal His tag.
NCBI Ref Seq NM_010591.2
RefSeq ORF Size 1005 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.