Online Inquiry
JMJD6 Knockout Cell Line
SPL-01761
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | JMJD6 |
| Gene Abbr. | JMJD6 |
| Gene ID | 23210 |
| Full Name | jumonji domain containing 6, arginine demethylase and lysine hydroxylase |
| Alias | PSR, PTDSR, PTDSR1 |
| Species | Human |
| Genomic Locus | chr17:76725777 |
| Transcript | NM_015167 |
| WT Expression Level | 40.53 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a nuclear protein with a JmjC domain. JmjC domain-containing proteins are predicted to function as protein hydroxylases or histone demethylases. This protein was first identified as a putative phosphatidylserine receptor involved in phagocytosis of apoptotic cells; however, subsequent studies have indicated that it does not directly function in the clearance of apoptotic cells, and questioned whether it is a true phosphatidylserine receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of JMJD6. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGAAAGACCTTACAAGCCCG |
| PCR Primer |
Forward: GTCAACTTCCTTCGGTTTGTCATTA Reverse: TCTTCATCTTCACTGAGTAGCCATC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.