JARID2 Knockout Cell Line - CD BioSciences

service-banner

JARID2 Knockout Cell Line

JARID2 Knockout Cell Line

SPL-01756

Size Price
1 Unit Online Inquiry
Description
13bp deletion
Target Information
Target Name JARID2
Gene Abbr. JARID2
Gene ID 3720
Full Name jumonji and AT-rich interaction domain containing 2
Alias JMJ
Species Human
Genomic Locus chr6:15374134
Transcript NM_004973
WT Expression Level 5.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of JARID2.
Description 13bp deletion
Parental Cell Line C631
Guide RNA Sequence TCCGTGGTCAGAAGAACGGG
PCR Primer Forward: ATTTCTGTTGCAGTGTACATTCTGG
Reverse: TCAACTCACCATTCACAGTTTTCAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.