Online Inquiry
JARID2 Knockout Cell Line
SPL-01755
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
11bp deletion |
Target Information | |
---|---|
Target Name | JARID2 |
Gene Abbr. | JARID2 |
Gene ID | 3720 |
Full Name | jumonji and AT-rich interaction domain containing 2 |
Alias | JMJ |
Species | Human |
Genomic Locus | chr6:15374134 |
Transcript | NM_004973 |
WT Expression Level | 5.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of JARID2. |
Description | 11bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TCCGTGGTCAGAAGAACGGG |
PCR Primer |
Forward: ATTTCTGTTGCAGTGTACATTCTGG Reverse: TCAACTCACCATTCACAGTTTTCAG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.