Online Inquiry
JAK2 cDNA ORF Clone, Human, C-Myc tag
SPD-09415
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human Janus kinase 2 with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Jak2 |
| Gene Abbr. | JAK2 |
| Gene ID | 3717 |
| Full Name | Janus kinase 2 |
| Alias | JTK10 |
| Introduction | Members of the Janus family of tyrosine kinases (Jak1, Jak2, Jak3, and Tyk2) are activated by ligands binding to a number of associated cytokine receptors. Upon cytokine receptor activation, Jak proteins become autophosphorylated and phosphorylate their associated receptors to provide multiple binding sites for signaling proteins. These associated signaling proteins, such as Stats Shc insulin receptor substrates and focal adhesion kinase (FAK) typically contain SH2 or other phospho-tyrosine-binding domains. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human Janus kinase 2 with C terminal Myc tag. |
| NCBI Ref Seq | NM_004972.3 |
| RefSeq ORF Size | 3444 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 489C/T,2490G/A not causing the amino acid variation. |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | KpnI (Three restriction sites) + NotI (6kb + 2.16kb + 0.06kb + 1.24kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.