JAG1 cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

JAG1 cDNA ORF Clone, Human, N-His tag

JAG1 cDNA ORF Clone, Human, N-His tag

SPD-09398

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human collagen triple helix repeat containing 1 with N terminal His tag.
Target Information
Species Human
Target Name Jagged1
Gene Abbr. JAG1
Gene ID 182
Full Name jagged canonical Notch ligand 1
Alias AGS, AGS1, AHD, AWS, CD339
Introduction Notch signaling is activated upon engagement of the Notch receptor with its ligands, the DSL (Delta, Serrate, Lag2) proteins of single-pass type I membrane proteins. The DSL proteins contain multiple EGF-like repeats and a DSL domain that is required for binding to Notch. Five DSL proteins have been identified in mammals: Jagged1, Jagged2, Delta-like (DLL) 1, 3 and 4. Ligand binding to the Notch receptor results in two sequential proteolytic cleavages of the receptor by the ADAM protease and the γ-secretase complex. The intracellular domain of Notch is released and then translocates to the nucleus where it activates transcription. Notch ligands may also be processed in a way similar to Notch, suggesting a bi-directional signaling through receptor-ligand interactions.Mutation in Jagged1 is associated with Alagille syndrome, an autosomal dominant disorder characterized by abnormal development of liver, heart, skeleton, eye, and face and Tetralogy of Fallot (ToF), a common form of complex congenital heart disease. Jagged1 expression is associated with prostate cancer metastasis and recurrence.
Product Details
Description Full length Clone DNA of Human collagen triple helix repeat containing 1 with N terminal His tag.
NCBI Ref Seq NM_000214.2
RefSeq ORF Size 3645 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 396G/A,2520 C/T,3411T/C not causing the amino acid variation.
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites HindIII + XbaI (6kb + 3.65kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.