Itgb5 cDNA ORF Clone, Mouse, C-Myc tag - CD BioSciences

service-banner

Itgb5 cDNA ORF Clone, Mouse, C-Myc tag

Itgb5 cDNA ORF Clone, Mouse, C-Myc tag

SPD-09191

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse integrin beta 5
Target Information
Species Mouse
Target Name Integrin
Gene Abbr. Itgb5
Gene ID 16419
Full Name integrin beta 5
Alias AA475909, AI874634, ESTM2, ESTM23, [b]-5
Introduction Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins having distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with extracellular environment (inside-out signaling).The αVβ5 integrin is expressed in various tissues and cell types, including endothelia, epithelia and fibroblasts. It plays a role in matrix adhesion to VN, FN, SPARC and bone sialoprotein and functions in the invasion of gliomas and metastatic carcinoma cells. αVβ5 integrin plays a major role in growth-factor-induced tumor angiogenesis, where cooperative signaling by the αVβ5 integrin and growth factors regulates endothelial cell proliferation and survival.
Product Details
Description Full length Clone DNA of Mouse integrin beta 5
NCBI Ref Seq NM_010580.2
RefSeq ORF Size 2496 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV mammalian cell promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI (two restriction sites) + XbaI (6kb + 1.53kb + 0.98kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.