Online Inquiry
ITGB5 cDNA ORF Clone, Human, C-Myc tag
SPD-09195
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human integrin, beta 5 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Integrin |
Gene Abbr. | ITGB5 |
Gene ID | 3693 |
Full Name | integrin subunit beta 5 |
Introduction | Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins having distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with extracellular environment (inside-out signaling).The αVβ5 integrin is expressed in various tissues and cell types, including endothelia, epithelia and fibroblasts. It plays a role in matrix adhesion to VN, FN, SPARC and bone sialoprotein and functions in the invasion of gliomas and metastatic carcinoma cells. αVβ5 integrin plays a major role in growth-factor-induced tumor angiogenesis, where cooperative signaling by the αVβ5 integrin and growth factors regulates endothelial cell proliferation and survival. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human integrin, beta 5 with C terminal Myc tag. |
NCBI Ref Seq | NM_002213.3 |
RefSeq ORF Size | 2445 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | HindIII + XbaI (6kb + 2.45kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.