ITGB4 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ITGB4 cDNA ORF Clone, Human, untagged

ITGB4 cDNA ORF Clone, Human, untagged

SPD-09190

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human integrin, beta 4, transcript variant 2.
Target Information
Species Human
Target Name Integrin
Gene Abbr. ITGB4
Gene ID 3691
Full Name integrin subunit beta 4
Alias CD104, GP150
Introduction Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins having distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with extracellular environment (inside-out signaling).
Product Details
Description Full length Clone DNA of Human integrin, beta 4, transcript variant 2.
NCBI Ref Seq NM_001005619.1
RefSeq ORF Size 5418 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.