Online Inquiry
ITGB3BP cDNA ORF Clone, Human, N-Myc tag
SPD-10819
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human integrin beta 3 binding protein (beta3-endonexin) with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | NRIF3 |
Gene Abbr. | ITGB3BP |
Gene ID | 23421 |
Full Name | integrin subunit beta 3 binding protein |
Alias | CENP-R, CENPR, HSU37139, NRIF3, TAP20 |
Introduction | ITGB3BP is a transcription coregulator that can have both coactivator and corepressor functions. Isoform 1, but not other isoforms, is involved in the coactivation of nuclear receptors for retinoid X (RXRs) and thyroid hormone (TRs) in a ligand-dependent fashion. ITGB3BP acts as a transcriptional corepressor via its interaction with the NFKB1 NF-kappa-B subunit, possibly by interfering with the transactivation domain of NFKB1. It induces apoptosis in breast cancer cells, but not in other cancer cells, via a caspase-2 mediated pathway that involves mitochondrial membrane permeabilization but does not require other caspases. ITGB3BP may also act as an inhibitor of cyclin A-associated kinase. ITGB3BP may be involved in incorporation of newly synthesized CENPA into centromeres via its interaction with the CENPA-NAC complex. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human integrin beta 3 binding protein (beta3-endonexin) with N terminal Myc tag. |
NCBI Ref Seq | NM_014288.4 |
RefSeq ORF Size | 534 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.