ITGB3BP cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

ITGB3BP cDNA ORF Clone, Human, N-HA tag

ITGB3BP cDNA ORF Clone, Human, N-HA tag

SPD-10820

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human integrin beta 3 binding protein (beta3-endonexin) with N terminal HA tag.
Target Information
Species Human
Target Name NRIF3
Gene Abbr. ITGB3BP
Gene ID 23421
Full Name integrin subunit beta 3 binding protein
Alias CENP-R, CENPR, HSU37139, NRIF3, TAP20
Introduction ITGB3BP is a transcription coregulator that can have both coactivator and corepressor functions. Isoform 1, but not other isoforms, is involved in the coactivation of nuclear receptors for retinoid X (RXRs) and thyroid hormone (TRs) in a ligand-dependent fashion. ITGB3BP acts as a transcriptional corepressor via its interaction with the NFKB1 NF-kappa-B subunit, possibly by interfering with the transactivation domain of NFKB1. It induces apoptosis in breast cancer cells, but not in other cancer cells, via a caspase-2 mediated pathway that involves mitochondrial membrane permeabilization but does not require other caspases. ITGB3BP may also act as an inhibitor of cyclin A-associated kinase. ITGB3BP may be involved in incorporation of newly synthesized CENPA into centromeres via its interaction with the CENPA-NAC complex.
Product Details
Description Full length Clone DNA of Human integrin beta 3 binding protein (beta3-endonexin) with N terminal HA tag.
NCBI Ref Seq NM_014288.4
RefSeq ORF Size 534 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.