ITGB3 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

ITGB3 cDNA ORF Clone, Human, N-FLAG tag

ITGB3 cDNA ORF Clone, Human, N-FLAG tag

SPD-09156

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) with N terminal Flag tag.
Target Information
Species Human
Target Name Integrin
Gene Abbr. ITGB3
Gene ID 3690
Full Name integrin subunit beta 3
Alias BDPLT16, BDPLT2, CD61, GP3A, GPIIIa
Introduction Integrins are heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling). αIIβ3 and αVβ3 are the two β3 containing integrins which are prominently expressed in hematopoietic cells and angiogenic endothelic cells and perform adhesive functions in hemostasis, wound healing and angiogenesis. Tyr773 and Tyr785 (usually referred to as Tyr747 and Tyr759 based on the chicken sequence) are phosphorylated upon ligand binding. Phosphorylation of these tyrosine residues is required for certain ligand-induced signaling. Thr779 (corresponding to Thr753 of the chicken sequence) of integrin β3 in the platelet specific αIIβ3 is phosphorylated by PKD and/or Akt, which may modulate integrin association with other signaling molecules.
Product Details
Description Full length Clone DNA of Human integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) with N terminal Flag tag.
NCBI Ref Seq NM_000212.2
RefSeq ORF Size 2367 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1029A/G not causing the amino acid variation.
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites HindIII + XbaI (6kb + 2.38kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.