Online Inquiry
ITGB3 cDNA ORF Clone, Human, C-FLAG tag
SPD-09151
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Integrin |
Gene Abbr. | ITGB3 |
Gene ID | 3690 |
Full Name | integrin subunit beta 3 |
Alias | BDPLT16, BDPLT2, CD61, GP3A, GPIIIa |
Introduction | Integrins are heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling). αIIβ3 and αVβ3 are the two β3 containing integrins which are prominently expressed in hematopoietic cells and angiogenic endothelic cells and perform adhesive functions in hemostasis, wound healing and angiogenesis. Tyr773 and Tyr785 (usually referred to as Tyr747 and Tyr759 based on the chicken sequence) are phosphorylated upon ligand binding. Phosphorylation of these tyrosine residues is required for certain ligand-induced signaling. Thr779 (corresponding to Thr753 of the chicken sequence) of integrin β3 in the platelet specific αIIβ3 is phosphorylated by PKD and/or Akt, which may modulate integrin association with other signaling molecules. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) with C terminal Flag tag. |
NCBI Ref Seq | NM_000212.2 |
RefSeq ORF Size | 2367 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1020A>G not causing the amino acid variation. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + XbaI (6kb + 2.41kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.