ITGB2 cDNA ORF Clone, Rhesus, N-His tag - CD BioSciences

service-banner

ITGB2 cDNA ORF Clone, Rhesus, N-His tag

ITGB2 cDNA ORF Clone, Rhesus, N-His tag

SPD-09117

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus integrin beta-2-like with N terminal His tag.
Target Information
Species Rhesus
Target Name Integrin
Gene Abbr. ITGB2
Gene ID 710577
Full Name integrin subunit beta 2
Introduction Integrins are transmembrane glycoproteins that form heterodimers consisting of one α and one β subunit. Integrin dimers act as receptors for extracellular matrix proteins and cell-surface ligands. Integrin signaling to (inside-out) and from (outside-in) extracellular molecules regulates multiple cellular processes, such as development, wound healing, immune response, invasion, metastasis, and angiogenesis. Integrin β2 (CD18) is the β subunit of the leukocyte-specific integrin family. Leukocyte integrins include Integrin β2 (CD18)/αL (CD11a) (LFA-1, lymphocyte function associated antigen 1), Integrin β2 (CD18)/αM (CD11b) (Mac-1), Integrin β2 (CD18)/αX (CD11c), and Integrin β2 (CD18)/αD (CD11d). These integrins bind to immunoglobulin superfamily members, such as ICAM-1 and VCAM-1 on endothelial cells, to mediate firm adhesion and transendothelial migration of leukocytes. Integrin β2 (CD18) deficiency results in LAD (leukocyte adhesion deficiency), a disease characterized by impairment of leukocyte recruitment resulting in inability to fight infection.
Product Details
Description Full length Clone DNA of Rhesus integrin beta-2-like with N terminal His tag.
NCBI Ref Seq XR_012415.2
RefSeq ORF Size 1014 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.