Itgb2 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Itgb2 cDNA ORF Clone, Mouse, N-FLAG tag

Itgb2 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-09126

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse integrin beta 2 with N terminal Flag tag.
Target Information
Species Mouse
Target Name Integrin
Gene Abbr. Itgb2
Gene ID 16414
Full Name integrin beta 2
Alias 2E6, AI528527, Cd18, LAD, LCAMB
Introduction Integrins are transmembrane glycoproteins that form heterodimers consisting of one α and one β subunit. Integrin dimers act as receptors for extracellular matrix proteins and cell-surface ligands. Integrin signaling to (inside-out) and from (outside-in) extracellular molecules regulates multiple cellular processes, such as development, wound healing, immune response, invasion, metastasis, and angiogenesis. Integrin β2 (CD18) is the β subunit of the leukocyte-specific integrin family. Leukocyte integrins include Integrin β2 (CD18)/αL (CD11a) (LFA-1, lymphocyte function associated antigen 1), Integrin β2 (CD18)/αM (CD11b) (Mac-1), Integrin β2 (CD18)/αX (CD11c), and Integrin β2 (CD18)/αD (CD11d). These integrins bind to immunoglobulin superfamily members, such as ICAM-1 and VCAM-1 on endothelial cells, to mediate firm adhesion and transendothelial migration of leukocytes. Integrin β2 (CD18) deficiency results in LAD (leukocyte adhesion deficiency), a disease characterized by impairment of leukocyte recruitment resulting in inability to fight infection.
Product Details
Description Full length Clone DNA of Mouse integrin beta 2 with N terminal Flag tag.
NCBI Ref Seq NM_008404.4
RefSeq ORF Size 2313 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + NotI (6kb + 2.4kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.