Online Inquiry
ITGB2 cDNA ORF Clone, Human, N-Myc tag
SPD-09138
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Integrin |
Gene Abbr. | ITGB2 |
Gene ID | 3689 |
Full Name | integrin subunit beta 2 |
Alias | CD18, LAD, LCAMB, LFA-1, MAC-1 |
Introduction | Integrins are transmembrane glycoproteins that form heterodimers consisting of one α and one β subunit. Integrin dimers act as receptors for extracellular matrix proteins and cell-surface ligands. Integrin signaling to (inside-out) and from (outside-in) extracellular molecules regulates multiple cellular processes, such as development, wound healing, immune response, invasion, metastasis, and angiogenesis. Integrin β2 (CD18) is the β subunit of the leukocyte-specific integrin family. Leukocyte integrins include Integrin β2 (CD18)/αL (CD11a) (LFA-1, lymphocyte function associated antigen 1), Integrin β2 (CD18)/αM (CD11b) (Mac-1), Integrin β2 (CD18)/αX (CD11c), and Integrin β2 (CD18)/αD (CD11d). These integrins bind to immunoglobulin superfamily members, such as ICAM-1 and VCAM-1 on endothelial cells, to mediate firm adhesion and transendothelial migration of leukocytes. Integrin β2 (CD18) deficiency results in LAD (leukocyte adhesion deficiency), a disease characterized by impairment of leukocyte recruitment resulting in inability to fight infection. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) with N terminal Myc tag. |
NCBI Ref Seq | NM_000211.3 |
RefSeq ORF Size | 2310 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.