Itgb1bp1 cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Itgb1bp1 cDNA ORF Clone, Mouse, N-His tag

Itgb1bp1 cDNA ORF Clone, Mouse, N-His tag

SPD-06594

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse integrin beta 1 binding protein 1 with N terminal His tag.
Target Information
Species Mouse
Target Name ICAP-1
Gene Abbr. Itgb1bp1
Gene ID 16413
Full Name integrin beta 1 binding protein 1
Alias AI449260, AU019480, Icap1, bod
Introduction The cytoplasmic domains of integrins are essential for cell adhesion. The protein encoded by this gene binds to the beta1 integrin cytoplasmic domain. The interaction between this protein and beta1 integrin is highly specific. Two isoforms of this protein are derived from alternatively spliced transcripts. The shorter form of this protein does not interact with the beta1 integrin cytoplasmic domain. The longer form is a phosphoprotein and the extent of its phosphorylation is regulated by the cell-matrix interaction, suggesting an important role of this protein during integrin-dependent cell adhesion. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Mouse integrin beta 1 binding protein 1 with N terminal His tag.
NCBI Ref Seq NM_008403.4
RefSeq ORF Size 603 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.