Online Inquiry
Itgb1bp1 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-06588
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse integrin beta 1 binding protein 1 with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | ICAP-1 |
| Gene Abbr. | Itgb1bp1 |
| Gene ID | 16413 |
| Full Name | integrin beta 1 binding protein 1 |
| Alias | AI449260, AU019480, Icap1, bod |
| Introduction | The cytoplasmic domains of integrins are essential for cell adhesion. The protein encoded by this gene binds to the beta1 integrin cytoplasmic domain. The interaction between this protein and beta1 integrin is highly specific. Two isoforms of this protein are derived from alternatively spliced transcripts. The shorter form of this protein does not interact with the beta1 integrin cytoplasmic domain. The longer form is a phosphoprotein and the extent of its phosphorylation is regulated by the cell-matrix interaction, suggesting an important role of this protein during integrin-dependent cell adhesion. [provided by RefSeq] |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse integrin beta 1 binding protein 1 with C terminal Flag tag. |
| NCBI Ref Seq | NM_008403.4 |
| RefSeq ORF Size | 603 bp |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.