ITGB1 cDNA ORF Clone, Rhesus, C-Myc tag - CD BioSciences

service-banner

ITGB1 cDNA ORF Clone, Rhesus, C-Myc tag

ITGB1 cDNA ORF Clone, Rhesus, C-Myc tag

SPD-09072

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) with C terminal Myc tag.
Target Information
Species Rhesus
Target Name Integrin
Gene Abbr. ITGB1
Gene ID 574312
Full Name integrin subunit beta 1
Introduction Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).The β1 subfamily includes 12 distinct integrin proteins that bind to different extracellular matrix molecules. Control of extracellular integrin binding influences cell adhesion and migration, while intracellular signaling messages relayed by the β1 cytoplasmic tail help to regulate cell proliferation, cytoskeletal reorganization, and gene expression. Research studies have implicated β1 integrin in various activities including embryonic development, blood vessel, skin, bone, and muscle formation, as well as tumor metastasis and angiogenesis.
Product Details
Description Full length Clone DNA of Rhesus integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) with C terminal Myc tag.
NCBI Ref Seq XM_002805609.1
RefSeq ORF Size 2397 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.