ITGB1 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

ITGB1 cDNA ORF Clone, Human, N-FLAG tag

ITGB1 cDNA ORF Clone, Human, N-FLAG tag

SPD-09106

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with N terminal Flag tag.
Target Information
Species Human
Target Name Integrin
Gene Abbr. ITGB1
Gene ID 3688
Full Name integrin subunit beta 1
Alias CD29, FNRB, GPIIA, MDF2, MSK12
Introduction Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).The β1 subfamily includes 12 distinct integrin proteins that bind to different extracellular matrix molecules. Control of extracellular integrin binding influences cell adhesion and migration, while intracellular signaling messages relayed by the β1 cytoplasmic tail help to regulate cell proliferation, cytoskeletal reorganization, and gene expression. Research studies have implicated β1 integrin in various activities including embryonic development, blood vessel, skin, bone, and muscle formation, as well as tumor metastasis and angiogenesis.
Product Details
Description Full length Clone DNA of Human integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with N terminal Flag tag.
NCBI Ref Seq NM_002211.3
RefSeq ORF Size 2397 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 498T/C not causing the amino acid variation.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 2.44kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.