Online Inquiry
ITGB1 cDNA ORF Clone, Human, C-His tag
SPD-09102
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with C terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Integrin |
Gene Abbr. | ITGB1 |
Gene ID | 3688 |
Full Name | integrin subunit beta 1 |
Alias | CD29, FNRB, GPIIA, MDF2, MSK12 |
Introduction | Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).The β1 subfamily includes 12 distinct integrin proteins that bind to different extracellular matrix molecules. Control of extracellular integrin binding influences cell adhesion and migration, while intracellular signaling messages relayed by the β1 cytoplasmic tail help to regulate cell proliferation, cytoskeletal reorganization, and gene expression. Research studies have implicated β1 integrin in various activities including embryonic development, blood vessel, skin, bone, and muscle formation, as well as tumor metastasis and angiogenesis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with C terminal His tag. |
NCBI Ref Seq | NM_002211.3 |
RefSeq ORF Size | 2397 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.