ITGAX cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ITGAX cDNA ORF Clone, Human, untagged

ITGAX cDNA ORF Clone, Human, untagged

SPD-09069

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human integrin, alpha X (complement component 3 receptor 4 subunit).
Target Information
Species Human
Target Name Integrin
Gene Abbr. ITGAX
Gene ID 3687
Full Name integrin subunit alpha X
Alias CD11C, SLEB6
Introduction CD11c (integrin αX, ITGAX) is a transmembrane glycoprotein that forms an α/β heterodimer with CD18 (integrin β2), which interacts with a variety of extracellular matrix molecules and cell surface proteins. CD11c is primarily used as a dendritic cell marker. Dendritic cells can be classified into two major types: CD11c+ conventional dendritic cells that specialize in antigen presentation, and CD11c- plasmacytoid dendritic cells that specialize in type I interferon production. CD11c expression has also been observed on activated NK cells, subsets of B cells, monocytes, granulocytes, and some B cell malignancies including hairy cell leukemia.
Product Details
Description Full length Clone DNA of Human integrin, alpha X (complement component 3 receptor 4 subunit).
NCBI Ref Seq NM_000887.3
RefSeq ORF Size 3492 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2538G/A not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 3.49kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.