Online Inquiry
ITGAX cDNA ORF Clone, Human, C-HA tag
SPD-09063
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human integrin, alpha X (complement component 3 receptor 4 subunit) with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Integrin |
| Gene Abbr. | ITGAX |
| Gene ID | 3687 |
| Full Name | integrin subunit alpha X |
| Alias | CD11C, SLEB6 |
| Introduction | CD11c (integrin αX, ITGAX) is a transmembrane glycoprotein that forms an α/β heterodimer with CD18 (integrin β2), which interacts with a variety of extracellular matrix molecules and cell surface proteins. CD11c is primarily used as a dendritic cell marker. Dendritic cells can be classified into two major types: CD11c+ conventional dendritic cells that specialize in antigen presentation, and CD11c- plasmacytoid dendritic cells that specialize in type I interferon production. CD11c expression has also been observed on activated NK cells, subsets of B cells, monocytes, granulocytes, and some B cell malignancies including hairy cell leukemia. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human integrin, alpha X (complement component 3 receptor 4 subunit) with C terminal HA tag. |
| NCBI Ref Seq | NM_000887.3 |
| RefSeq ORF Size | 3534 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2538G/A not causing the amino acid variation. |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 3.53kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.