Itgav cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Itgav cDNA ORF Clone, Mouse, N-FLAG tag

Itgav cDNA ORF Clone, Mouse, N-FLAG tag

SPD-09045

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse integrin alpha V with N terminal Flag tag.
Target Information
Species Mouse
Target Name Integrin
Gene Abbr. Itgav
Gene ID 16410
Full Name integrin alpha V
Alias 1110004F14Rik, 2610028E01Rik, CD51, D430040G12Rik
Introduction Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlaping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).Several αV subfamily members, including αVβ3, αVβ5, αVβ1, are highly expressed in active endothelial cells and cancer cells (3-6) where they play a critical role in angiogenesis and tumor metastasis. Therefore, interest has focused on αV integrin as a key therapeutic target in the treatment of cancer.
Product Details
Description Full length Clone DNA of Mouse integrin alpha V with N terminal Flag tag.
NCBI Ref Seq NM_008402.2
RefSeq ORF Size 3135 bp
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.