Online Inquiry
ITGAV cDNA ORF Clone, Human, N-Myc tag
SPD-09056
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Integrin |
Gene Abbr. | ITGAV |
Gene ID | 3685 |
Full Name | integrin subunit alpha V |
Alias | CD51, MSK8, VNRA, VTNR |
Introduction | Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlaping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).Several αV subfamily members, including αVβ3, αVβ5, αVβ1, are highly expressed in active endothelial cells and cancer cells (3-6) where they play a critical role in angiogenesis and tumor metastasis. Therefore, interest has focused on αV integrin as a key therapeutic target in the treatment of cancer. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) with N terminal Myc tag. |
NCBI Ref Seq | NM_002210.4 |
RefSeq ORF Size | 3150 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2031C/T not causing the amino acid variation. |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | KpnI + XbaI (6kb + 3.15kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.