Online Inquiry
Itgam cDNA ORF Clone, Mouse, C-FLAG tag
SPD-09028
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse integrin alpha M |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Integrin |
| Gene Abbr. | Itgam |
| Gene ID | 16409 |
| Full Name | integrin alpha M |
| Alias | CD11b/CD18, CR, CR3, CR3A, Cd11b |
| Introduction | Cluster of differentiation molecule 11b (CD11b)/Integrin alpha M (ITGAM) is a transmembrane protein forming heterodimers that are composed of α and β subunits. CD11b is expressed by, and commonly used as a marker for, myeloid lineage cells, including neutrophils, monocytes, macrophages, and microglia. CD11b is phosphorylated at Ser1126 (cytoplasmic tail) in neutrophils. Research has shown that this phosphorylation event plays a role for leukocytes traveling from the blood stream to tissues. Furthermore, genome-wide association studies have linked CD11b to autoimmune diseases, such as systemic lupus erythematous (SLE). |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse integrin alpha M |
| NCBI Ref Seq | NM_001082960.1 |
| RefSeq ORF Size | 3504 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV mammalian cell promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI (two restriction sites) + XbaI (6kb + 1.32kb + 2.19kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.