ITGAM cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

ITGAM cDNA ORF Clone, Human, C-FLAG tag

ITGAM cDNA ORF Clone, Human, C-FLAG tag

SPD-09029

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human integrin, alpha M (complement component 3 receptor 3 subunit) with C terminal Flag tag.
Target Information
Species Human
Target Name Integrin
Gene Abbr. ITGAM
Gene ID 3684
Full Name integrin subunit alpha M
Alias CD11B, CR3A, MAC-1, MAC1A, MO1A
Introduction Cluster of differentiation molecule 11b (CD11b)/Integrin alpha M (ITGAM) is a transmembrane protein forming heterodimers that are composed of α and β subunits. CD11b is expressed by, and commonly used as a marker for, myeloid lineage cells, including neutrophils, monocytes, macrophages, and microglia. CD11b is phosphorylated at Ser1126 (cytoplasmic tail) in neutrophils. Research has shown that this phosphorylation event plays a role for leukocytes traveling from the blood stream to tissues. Furthermore, genome-wide association studies have linked CD11b to autoimmune diseases, such as systemic lupus erythematous (SLE).
Product Details
Description Full length Clone DNA of Human integrin, alpha M (complement component 3 receptor 3 subunit) with C terminal Flag tag.
NCBI Ref Seq NM_000632.3
RefSeq ORF Size 3498 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6kb + 3.5kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.