Online Inquiry
Itgal cDNA ORF Clone, Rat, N-HA tag
SPD-09016
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rat integrin, alpha L with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Rat |
| Target Name | Integrin |
| Gene Abbr. | Itgal |
| Gene ID | 308995 |
| Full Name | integrin subunit alpha L |
| Alias | LFA-1 |
| Introduction | CD11α, also known as integrin alpha-L (ITGAL), is the alpha chain of the lymphocyte function-associated antigen-1 (LFA-1). CD11α combines with the beta chain CD18 (ITGB2) to form LFA-1, an integrin expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands ICAM-1, 2, 3, and 4 F11R/JAM-1, and the secreted form of ubiquitin-like protein ISG15. LFA-1 is involved in a variety of immune phenomena including leukocyte-endothelial cell interaction and transmigration, cytotoxic T cell co-stimulation cytotoxic NK cell mediated killing leukocyte clearance and antibody-dependent killing by granulocytes and monocytes. LFA-1 is required for generation of common lymphoid progenitor cells in bone marrow, indicating a role in lymphopoiesis. High expression of CD11α has been associated with antigen-specific and tumor-reactive T cells. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rat integrin, alpha L with N terminal HA tag. |
| NCBI Ref Seq | NM_001033998.2 |
| RefSeq ORF Size | 3483 bp |
| Vector | pCMV3-SP-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.