ITGAL cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

ITGAL cDNA ORF Clone, Human, C-HA tag

ITGAL cDNA ORF Clone, Human, C-HA tag

SPD-09021

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide) with C terminal HA tag.
Target Information
Species Human
Target Name Integrin
Gene Abbr. ITGAL
Gene ID 3683
Full Name integrin subunit alpha L
Alias CD11A, LFA-1, LFA1A
Introduction CD11α, also known as integrin alpha-L (ITGAL), is the alpha chain of the lymphocyte function-associated antigen-1 (LFA-1). CD11α combines with the beta chain CD18 (ITGB2) to form LFA-1, an integrin expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands ICAM-1, 2, 3, and 4 F11R/JAM-1, and the secreted form of ubiquitin-like protein ISG15. LFA-1 is involved in a variety of immune phenomena including leukocyte-endothelial cell interaction and transmigration, cytotoxic T cell co-stimulation cytotoxic NK cell mediated killing leukocyte clearance and antibody-dependent killing by granulocytes and monocytes. LFA-1 is required for generation of common lymphoid progenitor cells in bone marrow, indicating a role in lymphopoiesis. High expression of CD11α has been associated with antigen-specific and tumor-reactive T cells.
Product Details
Description Full length Clone DNA of Human integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide) with C terminal HA tag.
NCBI Ref Seq NM_002209.2
RefSeq ORF Size 3513 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.