Online Inquiry
Itgae cDNA ORF Clone, Mouse, C-FLAG tag
SPD-09007
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse integrin alpha E, epithelial-associated with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Integrin |
| Gene Abbr. | Itgae |
| Gene ID | 16407 |
| Full Name | integrin alpha E, epithelial-associated |
| Alias | A530055J10, CD103, aM290, alph, alpha-E1 |
| Introduction | Cluster of differentiation molecule 103 (CD103)/Integrin, alpha E (ITGAE) is a transmembrane protein forming heterodimers that are composed of α and β subunits. CD103/ITGAE is expressed by subsets of CD4+ and CD8+ T cells, dendritic cells, and mast cells in mucosal tissues. The heterodimer composed of CD103/ITGAE and integrin beta 7 interacts with E-cadherin, a cellular adhesion molecule found on epithelial cells. The CD103/ITGAE and integrin beta 7 complex plays a role in thymocyte proliferation, intestinal T cell homing, and the antitumor immune response. Studies have shown that the presence of CD103/ITGAE(+) immune cells can be used as markers for a favorable prognosis in different epithelial cancers. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse integrin alpha E, epithelial-associated with C terminal Flag tag. |
| NCBI Ref Seq | NM_008399.1 |
| RefSeq ORF Size | 3504 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 3048G/A, 882A/G, 930G/T not causing the amino acid variation. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | HindIII + XbaI (6kb + 3.54kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.