Itgad cDNA ORF Clone, Rat, N-HA tag - CD BioSciences

service-banner

Itgad cDNA ORF Clone, Rat, N-HA tag

Itgad cDNA ORF Clone, Rat, N-HA tag

SPD-09004

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat integrin, alpha D with N terminal HA tag.
Target Information
Species Rat
Target Name Integrin
Gene Abbr. Itgad
Gene ID 64350
Full Name integrin subunit alpha M
Alias Itgax
Introduction Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).
Product Details
Description Full length Clone DNA of Rat integrin, alpha D with N terminal HA tag.
NCBI Ref Seq NM_031691.1
RefSeq ORF Size 3519 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 3.52kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.