Online Inquiry
ITGA6 Knockout Cell Line
SPL-01743
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 34bp deletion |
| Target Information | |
|---|---|
| Target Name | Integrin |
| Gene Abbr. | ITGA6 |
| Gene ID | 3655 |
| Full Name | integrin subunit alpha 6 |
| Alias | CD49f, ITGA6B, VLA-6 |
| Species | Human |
| Genomic Locus | chr2:172465556 |
| Transcript | NM_001079818 |
| WT Expression Level | 19.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 6 subunit. This subunit may associate with a beta 1 or beta 4 subunit to form an integrin that interacts with extracellular matrix proteins including members of the laminin family. The alpha 6 beta 4 integrin may promote tumorigenesis, while the alpha 6 beta 1 integrin may negatively regulate erbB2/HER2 signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 34bp deletion in a coding exon of ITGA6. |
| Description | 34bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGAAGCGCTTCTGCCCGCG |
| PCR Primer |
Forward: TACATTTGTTCTCACTCACTGCCTA Reverse: GAATAAATGTTTGTCCCCACTCTCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.