ITGA6 Knockout Cell Line - CD BioSciences

service-banner

ITGA6 Knockout Cell Line

ITGA6 Knockout Cell Line

SPL-01742

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name Integrin
Gene Abbr. ITGA6
Gene ID 3655
Full Name integrin subunit alpha 6
Alias CD49f, ITGA6B, VLA-6
Species Human
Genomic Locus chr2:172465556
Transcript NM_001079818
WT Expression Level 19.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 6 subunit. This subunit may associate with a beta 1 or beta 4 subunit to form an integrin that interacts with extracellular matrix proteins including members of the laminin family. The alpha 6 beta 4 integrin may promote tumorigenesis, while the alpha 6 beta 1 integrin may negatively regulate erbB2/HER2 signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of ITGA6.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence TGGAAGCGCTTCTGCCCGCG
PCR Primer Forward: TACATTTGTTCTCACTCACTGCCTA
Reverse: GAATAAATGTTTGTCCCCACTCTCC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.