ITGA6 cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

ITGA6 cDNA ORF Clone, Rhesus, untagged

ITGA6 cDNA ORF Clone, Rhesus, untagged

SPD-08934

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus integrin, alpha 6.
Target Information
Species Rhesus
Target Name Integrin
Gene Abbr. ITGA6
Gene ID 697643
Full Name integrin subunit alpha 6
Introduction Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).Integrin α6 is a 120 kDa protein with two splice variants, integrin α6, 6A and 6B which function as receptors for laminins on the basal membrane to mediate cellular adhesion events. α6 integrins have been shown to play an important role in hematopoietic stem and progenitor cell homing to the bone marrow.
Product Details
Description Full length Clone DNA of Rhesus integrin, alpha 6.
NCBI Ref Seq XM_001086200.2
RefSeq ORF Size 3276 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.