Online Inquiry
Itga6 cDNA ORF Clone, Rat, untagged
SPD-08944
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rat integrin, alpha 6. |
| Target Information | |
|---|---|
| Species | Rat |
| Target Name | Integrin |
| Gene Abbr. | Itga6 |
| Gene ID | 114517 |
| Full Name | integrin subunit alpha 6 |
| Introduction | Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).Integrin α6 is a 120 kDa protein with two splice variants, integrin α6, 6A and 6B which function as receptors for laminins on the basal membrane to mediate cellular adhesion events. α6 integrins have been shown to play an important role in hematopoietic stem and progenitor cell homing to the bone marrow. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rat integrin, alpha 6. |
| NCBI Ref Seq | XM_006234351.1 |
| RefSeq ORF Size | 3273 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 87C/G,2922C/A,3024T/C not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + NotI (6.1kb + 3.27kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.