Online Inquiry
Itga5 cDNA ORF Clone, Mouse, N-His tag
SPD-08911
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse integrin alpha 5 (fibronectin receptor alpha) with N terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Integrin |
Gene Abbr. | Itga5 |
Gene ID | 16402 |
Full Name | integrin alpha 5 (fibronectin receptor alpha) |
Alias | Cd49e, F, Fnra, VLA5 |
Introduction | Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).Integrin α5/β1 is involved in multiple biological processes including embryonic development, angiogenesis and tumor metastasis. By interaction with its fibronectin ligand, α5/β1 transduces signals that regulate cell adhesion, migration, matrix assembly and cytoskeletal organization. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse integrin alpha 5 (fibronectin receptor alpha) with N terminal His tag. |
NCBI Ref Seq | NM_010577.2 |
RefSeq ORF Size | 3162 bp |
Vector | pCMV3-SP-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.