Online Inquiry
ITGA2B Knockout Cell Line
SPL-01741
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | Integrin |
| Gene Abbr. | ITGA2B |
| Gene ID | 3674 |
| Full Name | integrin subunit alpha 2b |
| Alias | BDPLT16, BDPLT2, CD41, CD41B, GP2B |
| Species | Human |
| Genomic Locus | chr17:44385638 |
| Transcript | NM_000419 |
| WT Expression Level | 4.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of ITGA2B. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCCCGTAGGTAGCTGCTTTT |
| PCR Primer |
Forward: CTTCACAGTAACGCTTGTCCCAG Reverse: ATGTAGGCTCCCAAACTTTACAAAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.