Itga2b cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Itga2b cDNA ORF Clone, Mouse, untagged

Itga2b cDNA ORF Clone, Mouse, untagged

SPD-08833

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse integrinalpha2b.
Target Information
Species Mouse
Target Name Integrin
Gene Abbr. Itga2b
Gene ID 16399
Full Name integrin alpha 2b
Alias AI172977, CD41, CD41B, Gp, GpIIb
Introduction Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).Integrin α2b is a cell-surface adhesion molecule that undergoes proteolytic cleavage to yield disulfide-linked heavy and light chains, which together with glycoprotein IIIb, forms a major fibrinogen receptor in activated platelets. Mutations in the corresponding ITGA2B gene can result in Glanzmann thrombasthenia, a bleeding disorder characterized by lack of platelet aggregation.
Product Details
Description Full length Clone DNA of Mouse integrinalpha2b.
NCBI Ref Seq NM_010575.2
RefSeq ORF Size 3102 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1674 G/A not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 3.1kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.